This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

BRAF Gene Mutation Analysis in Colorectal Cancer in South of Iran


1 Department of Pathology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran
2 Transplant Research Center, Department of Pathology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran
3 Department of Pathology, Molecular Laboratory, School of Medicine, Namazi Teaching Hospital, Shiraz University of Medical Sciences, Shiraz, IR Iran
*Corresponding author: Bita Geramizadeh, Transplant Research Center, Department of Pathology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, IR Iran. Tel/Fax: +98-7116474331, E-mail: geramib@sums.ac.ir.
Annals of Colorectal Research. 2014 June; 2(2): e19917 , DOI: 10.17795/acr-19917
Article Type: Research Article; Received: May 1, 2014; Accepted: May 5, 2014; epub: Jun 29, 2014; ppub: Jun 30, 2014

Abstract


Background: Colorectal carcinoma is the third most commonly diagnosed cancer worldwide and many studies have focused on its molecular basis. BRAF V600E is the single most important mutation of this gene in cancers. It shows variable, but usually low, frequency in colorectal cancer, but is associated with distinct histologic, prognostic and molecular features. It is highly associated with MSI (microsatellite instability), CIMP-H (CpG island methylator phenotype), serrated pathway, poor prognosis and resistance to anti-EGFR (epidermal growth factor) drugs and interestingly absent in Lynch syndrome.

Objectives: In this study, we analyzed BRAF V600E mutation in colorectal cancer in Iranian patients.

Patients and Methods: One hundred patients with colorectal cancer, operated in hospitals affiliated to Shiraz University of medical Sciences (Faghihi and Namazi Hospital) were selected. The cases were chosen from the pathology files of the above mentioned hospitals, during 2011-2013. Genomic DNA were extracted from the paraffin blocks, by the DNP TM kit, amplified using conventional PCR and DNA sequenced using the automated sequencer (Sanger method).

Results: Patients were 21-87 years old (mean = 59.8), 45% female and 55% male. Thirty percent of the cases had right-sided and 70% left-sided cancer, of which 83% were well and 17% moderately differentiated. No BRAF V600E mutation was detected in these 100 cases.

Conclusions: The BRAF mutation is not common in colorectal cancer patients in the South of Iran. Our results are very similar to very few previous studies conducted in Iran, although we suggest further studies with larger numbers of patients to confirm these results.

Keywords: Colorectal Cancer; Gene; Iran

1. Background


Colorectal cancer (CRC) is the third most common cancer in men, the second in women and the fourth-leading cause of cancer death worldwide (1). Pathological staging is one of the most reliable prognostic markers for therapeutic modality selection, but CRC is a heterogeneous disease and, for instance, 10%–20% of patients with stage II cancer develop recurrence (2). Many efforts have been made for CRC molecular classification, in order to properly diagnosis, predict the natural course and prognosis, treat and define the pathogenesis of this disease. Multiple pathways have been identified, including: (1) chromosomal instability (CIN), (2) microsatellite instability (MSI), (3) CpG island methylator phenotype (CIMP), (4) miRNA and (5) serrated pathway (3-7). The BRAF protein is the last discovered member of the RAF family in Mitosis activated protein kinase signaling pathway, which acts with KRAS, as a downstream serine-threonine kinase effector, downstream to epidermal growth factor receptor (EGFR) and promoting cell proliferation (8). The most prevalent mutation in the BRAF gene in all cancers involves transversion of thymidine to adenosine, at the nucleotide position 1799 of exon 15, leading to conversion of GTG codon (valine) to glutamic acid, labeled as V600E, accounting for more than 90% of the detected mutations in this gene (8, 9). The V600E BRAF gene mutation in colorectal cancer is associated with older age, female gender, proximal colon location, poor differentiation, mucinous histology, infiltrating lymphocytes and advanced stage (10, 11). The BRAF mutations occur more frequently in MSI and CIMP-H CRCs and only rarely with MSS CRCs and mutually exclusive with KRAS mutations (10, 12). The BRAF mutation seems to be an independent negative prognostic factor in CRCs (13, 14). The BRAF gene mutation analysis is also one step of a suggested molecular approach for hereditary non-polyposis colorectal cancer (HNPCC) syndrome exclusion by some studies (15, 16). Two monoclonal antibodies, cetuximab and panitumumab, target the epidermal growth factor receptor (EGFR), have been approved for the treatment of CRC (17). Analysis of mutational status of the BRAF, KRAS and PI3KCA, is recommended before initiating these new targeted therapies in patients with metastatic CRC by some studies (17, 18). The BRAF gene mutation has shown a diverse, but usually low, frequency of incidence in different studies.

2. Objectives


In Iran CRC is the third most common cancer in women and fifth in men, with an increased incidence during the recent years, parallel with the lifestyle changes, called westernization (19). There are limited numbers of studies on molecular events, like the BRAF mutation in CRC in Iran and this study was designed for the BRAF gene mutation analysis status in two large referral centers in South of Iran.

3. Patients and Methods


Total number of 100 formalin fixed paraffin embedded (FFPE) blocks from surgically resected tumors of 100 hospitalized newly diagnosed CRC patients in hospitals affiliated to Shiraz University of Medical Sciences, 2011-2013, were selected. These patients had not been on chemotherapy or radiotherapy and were not known cases of the familial adenopolyposis (FAP) syndrome. The related hematoxylin and eosin slides were examined by a pathologist for confirmation of the diagnosis of adenocarcinoma, having more than 50% tumoral tissue and no necrosis.

3.1. DNA Extraction and BRAF Mutation Detection

The FFPE blocks were cut into 10 sections with 10 μm thickness by microtome and collected in 1.5 mL Eppendorf tubes. Then the tissues were treated by xylene for deparaffinization as described by manufacture's guidelines. Genomic DNA was extracted using the CINNAGEN DNPTM kit. The isolated DNA was amplified using conventional PCR, which was performed using primers for exon 15 of the BRAF gene: 5’ AACTCTTCATAATGCTTGCTCTGA 3’ (forward) and 3’ AGTAACTCAGCAGCATCTCAGG 5’ (reverse). The following program was used: initial denaturation at 95°C for 10 minutes, followed by 40 cycles for denaturation at 95̊c for 45 seconds, annealing at 59°C for 45 seconds and elongation at 72°C for 45 seconds. After the last cycle, a final extension at 72°C for 10 minutes was performed. After ethidium bromide staining, PCR products were visualized on 1.5% agarose gel electrophoresis. DNA bands were distinguished using a 50 bp ladder, prepared by CINNAGENR (Figure 1). Afterwards, direct DNA sequencing of the 251 bp PCR-amplified product was performed bi-directionally with an ABI 3730XL automated sequencer (by Sanger method), using the above-mentioned primers. Results were analyzed using Chromas Lite version 2.01 software (Figures 2 and 3). Patients’ data were analyzed, using SPSS 17.0 program.

Figure 1.
Agarose Gel Electrophoresis of PCR (polymerase chain reaction) Products
Figure 2.
Wild-Type BRAF Gene in a Patient Sample
Figure 3.
Mutated BRAF Gene in Positive Control Specimen

4. Results


We tested 100 sample isolated DNA sequences, from CRC specimen FFPE blocks to identify the V600E BRAF gene mutation frequency. Age range was 21-87 (mean = 59.8 and SD = 15.55). Further data are shown in Table 1.

Table 1.
Frequency of Important Parameters in Colorectal Cancer Patients a

No V600E BRAF gene mutation was detected among the100 tested isolated DNAs from patients with CRC. No other BRAF gene mutations were identified in this 251 bp PCR-amplified product of exon 15.

5. Discussion


In the present study we analyzed the V600E BRAF gene mutation, using conventional PCR-amplified isolated DNAs of 100 patients with CRC by direct sequencing (Sanger's method). No V600E BRAF gene mutation was detected among the100 selected patients. Our findings were similar to that of the Naghibalhossaini et al. (20) and compatible with the very low frequency results reported by Brim et al. (21) and Ghaffarpour et al. (22). The reported frequency of V600E BRAF gene mutation in CRC ranges between 0 and 24% in different studies (Table 2).

Table 2.
BRAF Gene Mutation Frequency in Some Unselected Specimens of CRCs a

Different V600E BRAF gene mutation frequency reports can be due to the environmental and genetic factors in different ethnics, different mutation detection methods and presence of BRAF gene mutations other than V600E, in addition to different sampling methods. Based on the results presented in Table 2, it is obvious that in most East and South East Asian countries, like China, Thailand, Taiwan, Malaysia and South Korea this gene mutation has a low frequency and surprisingly other BRAF gene mutations have higher prevalence. Brim et al. analyzed 61 Omani (African origin), 53 Iranian (Caucasian origin) and 95 African American patients with CRC and found that 19%, 2% and 10% of them have V600E BRAF gene mutation, respectively (21). Hanna et al. investigated 83 Asian, 149 black and 195 white patients and found the V600E BRAF gene mutation in 4%, 8% and 17% of them, respectively. They concluded that the V600E BRAF gene mutation frequency was significantly lower in Asian patients, in comparison with white patients (P = 0.004) (41).

Chaiyapan et al. found no cases of V600E BRAF gene mutation in 133 patients with CRC, studied in Thailand (38). Yuen et al. from found four V600E and seven non-V600E BRAF gene mutations in 215 studied CRC cases in Hong Kong (42). In Iranian patients, two studies have shown very high frequencies of V600E BRAF gene mutation in thyroid papillary carcinoma (43, 44). Three previous studies, in addition to the present one, showed very low frequency of this hot-spot mutation in patients with CRC. Iran is a vast country with different ethnic groups, therefore more studies with higher number of patients from different cities and evaluation of other BRAF mutations are essential for more precise estimation of the BRAF mutation frequency in CRC and for developing regional management guidelines for patients' care.

Footnotes

Authors' Contributions: Farshid Javadi: performing the research and writing the manuscript, Bita Geramizadeh: idea of the research, performing the research and writing the manuscript and Mitra Mirzai: performing the laboratory tests.
Funding/Support: The present article was financially supported by Dean of Research, Shiraz University of Medical Sciences grants number 2968.

References


  • 1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127(12):2893-917. [DOI] [PubMed]
  • 2. Marisa L, de Reynies A, Duval A, Selves J, Gaub MP, Vescovo L, et al. Gene expression classification of colon cancer into molecular subtypes: characterization, validation, and prognostic value. PLoS Med. 2013;10(5):ee1001453 [DOI] [PubMed]
  • 3. Kanthan R, Senger JL, Kanthan SC. Molecular events in primary and metastatic colorectal carcinoma: a review. Patholog Res Int. 2012;2012:597497. [DOI] [PubMed]
  • 4. Takayama T, Miyanishi K, Hayashi T, Sato Y, Niitsu Y. Colorectal cancer: genetics of development and metastasis. J Gastroenterol. 2006;41(3):185-92. [DOI] [PubMed]
  • 5. Markowitz SD, Bertagnolli MM. Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 2009;361(25):2449-60. [DOI] [PubMed]
  • 6. Samowitz WS. Genetic and epigenetic changes in colon cancer. Exp Mol Pathol. 2008;85(1):64-7. [DOI] [PubMed]
  • 7. Vakiani E, Yantiss RK. Pathologic features and biologic importance of colorectal serrated polyps. Adv Anat Pathol. 2009;16(2):79-91. [DOI] [PubMed]
  • 8. Roskoski RJ. RAF protein-serine/threonine kinases: structure and regulation. Biochem Biophys Res Commun. 2010;399(3):313-7. [DOI] [PubMed]
  • 9. Cantwell-Dorris ER, O'Leary JJ, Sheils OM. BRAFV600E: implications for carcinogenesis and molecular therapy. Mol Cancer Ther. 2011;10(3):385-94. [DOI] [PubMed]
  • 10. Li WQ, Kawakami K, Ruszkiewicz A, Bennett G, Moore J, Iacopetta B. BRAF mutations are associated with distinctive clinical, pathological and molecular features of colorectal cancer independently of microsatellite instability status. Mol Cancer. 2006;5:2. [DOI] [PubMed]
  • 11. Tie J, Gibbs P, Lipton L, Christie M, Jorissen RN, Burgess AW, et al. Optimizing targeted therapeutic development: analysis of a colorectal cancer patient population with the BRAF(V600E) mutation. Int J Cancer. 2011;128(9):2075-84. [DOI] [PubMed]
  • 12. Velho S, Moutinho C, Cirnes L, Albuquerque C, Hamelin R, Schmitt F, et al. BRAF, KRAS and PIK3CA mutations in colorectal serrated polyps and cancer: primary or secondary genetic events in colorectal carcinogenesis? BMC Cancer. 2008;8:255. [DOI] [PubMed]
  • 13. Ogino S, Nosho K, Kirkner GJ, Kawasaki T, Meyerhardt JA, Loda M, et al. CpG island methylator phenotype, microsatellite instability, BRAF mutation and clinical outcome in colon cancer. Gut. 2009;58(1):90-6. [DOI] [PubMed]
  • 14. Yokota T, Ura T, Shibata N, Takahari D, Shitara K, Nomura M, et al. BRAF mutation is a powerful prognostic factor in advanced and recurrent colorectal cancer. Br J Cancer. 2011;104(5):856-62. [DOI] [PubMed]
  • 15. Rasuck CG, Leite SM, Komatsuzaki F, Ferreira AC, Oliveira VC, Gomes KB. Association between methylation in mismatch repair genes, V600E BRAF mutation and microsatellite instability in colorectal cancer patients. Mol Biol Rep. 2012;39(3):2553-60. [DOI] [PubMed]
  • 16. Jensen LH, Dysager L, Lindebjerg J, Kolvra S, Byriel L, Cruger DG. Molecular biology from bench-to-bedside - which colorectal cancer patients should be referred for genetic counselling and risk assessment. Eur J Cancer. 2010;46(10):1823-8. [DOI] [PubMed]
  • 17. Muhammad S, Jiang Z, Liu Z, Kaur K, Wang X. The role of EGFR monoclonal antibodies (MoABs) cetuximab/panitumab, and BRAF inhibitors in BRAF mutated colorectal cancer. J Gastrointest Oncol. 2013;4(1):72-81. [DOI] [PubMed]
  • 18. Katsios C, Ziogas DE, Roukos DH. Colorectal cancer: cetuximab, KRAS, BRAF, PIK3CA mutations and beyond. Expert Rev Gastroenterol Hepatol. 2010;4(5):525-9. [DOI] [PubMed]
  • 19. Pourhoseingholi MA, Zali MR. Colorectal cancer screening: Time for action in Iran. World J Gastrointest Oncol. 2012;4(4):82-3. [DOI] [PubMed]
  • 20. Naghibalhossaini F, Hosseini HM, Mokarram P, Zamani M. High frequency of genes' promoter methylation, but lack of BRAF V600E mutation among Iranian colorectal cancer patients. Pathol Oncol Res. 2011;17(4):819-25. [DOI] [PubMed]
  • 21. Brim H, Mokarram P, Naghibalhossaini F, Saberi-Firoozi M, Al-Mandhari M, Al-Mawaly K, et al. Impact of BRAF, MLH1 on the incidence of microsatellite instability high colorectal cancer in populations based study. Mol Cancer. 2008;7:68. [DOI] [PubMed]
  • 22. Ghaffarpour M, Mohammadi Pargoo E, Sobhani S, Pirmoradi S, Mostakhdemin Hosseini Z, Kamali F. PIK3CA and BRAF mutational status and association with clinicopathological features in Iranian colonrectal cancer patients. Cancer Res. 2011;71(8) [DOI]
  • 23. Nagasaka T, Sasamoto H, Notohara K, Cullings HM, Takeda M, Kimura K, et al. Colorectal cancer with mutation in BRAF, KRAS, and wild-type with respect to both oncogenes showing different patterns of DNA methylation. J Clin Oncol. 2004;22(22):4584-94. [DOI] [PubMed]
  • 24. Samowitz WS, Sweeney C, Herrick J, Albertsen H, Levin TR, Murtaugh MA, et al. Poor survival associated with the BRAF V600E mutation in microsatellite-stable colon cancers. Cancer Res. 2005;65(14):6063-9. [DOI] [PubMed]
  • 25. Miranda E, Destro A, Malesci A, Balladore E, Bianchi P, Baryshnikova E, et al. Genetic and epigenetic changes in primary metastatic and nonmetastatic colorectal cancer. Br J Cancer. 2006;95(8):1101-7. [DOI] [PubMed]
  • 26. Samowitz WS, Albertsen H, Sweeney C, Herrick J, Caan BJ, Anderson KE, et al. Association of smoking, CpG island methylator phenotype, and V600E BRAF mutations in colon cancer. J Natl Cancer Inst. 2006;98(23):1731-8. [DOI] [PubMed]
  • 27. Maestro ML, Vidaurreta M, Sanz-Casla MT, Rafael S, Veganzones S, Martinez A, et al. Role of the BRAF mutations in the microsatellite instability genetic pathway in sporadic colorectal cancer. Ann Surg Oncol. 2007;14(3):1229-36. [DOI] [PubMed]
  • 28. Lee S, Cho NY, Choi M, Yoo EJ, Kim JH, Kang GH. Clinicopathological features of CpG island methylator phenotype-positive colorectal cancer and its adverse prognosis in relation to KRAS/BRAF mutation. Pathol Int. 2008;58(2):104-13. [DOI] [PubMed]
  • 29. Bougatef K, Ouerhani S, Moussa A, Kourda N, Coulet F, Colas C, et al. Prevalence of mutations in APC, CTNNB1, and BRAF in Tunisian patients with sporadic colorectal cancer. Cancer Genet Cytogenet. 2008;187(1):12-8. [DOI] [PubMed]
  • 30. Asaka S, Arai Y, Nishimura Y, Yamaguchi K, Ishikubo T, Yatsuoka T, et al. Microsatellite instability-low colorectal cancer acquires a KRAS mutation during the progression from Dukes' A to Dukes' B. Carcinogenesis. 2009;30(3):494-9. [DOI] [PubMed]
  • 31. Vilkin A, Niv Y, Nagasaka T, Morgenstern S, Levi Z, Fireman Z, et al. Microsatellite instability, MLH1 promoter methylation, and BRAF mutation analysis in sporadic colorectal cancers of different ethnic groups in Israel. Cancer. 2009;115(4):760-9. [DOI] [PubMed]
  • 32. Li HT, Lu YY, An YX, Wang X, Zhao QC. KRAS, BRAF and PIK3CA mutations in human colorectal cancer: relationship with metastatic colorectal cancer. Oncol Rep. 2011;25(6):1691-7. [DOI] [PubMed]
  • 33. Luevano-Gonzalez A, Guzman AQ, Ancer Rodriguez J, Ortiz Lopez R, Rojas Martinez A, Gonzalez Guerrero JF, et al. Analysis of DNA mismatch repair proteins expression and BRAF V600E mutation in a subset of early- and late-onset colorectal carcinoma patients in Mexico. Arch Med Res. 2011;42(6):457-62. [DOI] [PubMed]
  • 34. Bond CE, Umapathy A, Buttenshaw RL, Wockner L, Leggett BA, Whitehall VL. Chromosomal instability in BRAF mutant, microsatellite stable colorectal cancers. PLoS One. 2012;7(10):ee47483 [DOI] [PubMed]
  • 35. Sylvester BE, Huo D, Khramtsov A, Zhang J, Smalling RV, Olugbile S, et al. Molecular analysis of colorectal tumors within a diverse patient cohort at a single institution. Clin Cancer Res. 2012;18(2):350-9. [DOI] [PubMed]
  • 36. Hsieh LL, Er TK, Chen CC, Hsieh JS, Chang JG, Liu TC. Characteristics and prevalence of KRAS, BRAF, and PIK3CA mutations in colorectal cancer by high-resolution melting analysis in Taiwanese population. Clin Chim Acta. 2012;413(19-20):1605-11. [DOI] [PubMed]
  • 37. Palomba G, Colombino M, Contu A, Massidda B, Baldino G, Pazzola A, et al. Prevalence of KRAS, BRAF, and PIK3CA somatic mutations in patients with colorectal carcinoma may vary in the same population: clues from Sardinia. J Transl Med. 2012;10:178. [DOI] [PubMed]
  • 38. Chaiyapan W, Duangpakdee P, Boonpipattanapong T, Kanngern S, Sangkhathat S. Somatic mutations of K-ras and BRAF in Thai colorectal cancer and their prognostic value. Asian Pac J Cancer Prev. 2013;14(1):329-32. [PubMed]
  • 39. Yip WK, Choo CW, Leong VC, Leong PP, Jabar MF, Seow HF. Molecular alterations of Ras-Raf-mitogen-activated protein kinase and phosphatidylinositol 3-kinase-Akt signaling pathways in colorectal cancers from a tertiary hospital at Kuala Lumpur, Malaysia. APMIS. 2013;121(10):954-66. [DOI] [PubMed]
  • 40. Aissi S, Buisine MP, Zerimech F, Kourda N, Moussa A, Manai M, et al. Somatic molecular changes and histo-pathological features of colorectal cancer in Tunisia. World J Gastroenterol. 2013;19(32):5286-94. [DOI] [PubMed]
  • 41. Hanna MC, Go C, Roden C, Jones RT, Pochanard P, Javed AY, et al. Colorectal cancers from distinct ancestral populations show variations in BRAF mutation frequency. PLoS One. 2013;8(9):ee74950 [DOI] [PubMed]
  • 42. Yuen ST, Davies H, Chan TL, Ho JW, Bignell GR, Cox C, et al. Similarity of the phenotypic patterns associated with BRAF and KRAS mutations in colorectal neoplasia. Cancer Res. 2002;62(22):6451-5. [PubMed]
  • 43. Ranjbari N, Almasi S, Mohammadi-Asl J, Rahim F. BRAF mutations in Iranian patients with papillary thyroid carcinoma. Asian Pac J Cancer Prev. 2013;14(4):2521-3. [PubMed]
  • 44. Mohammadi-Asl J, Larijani B, Khorgami Z, Tavangar SM, Haghpanah V, Mehdipour P. Prevalence of BRAF V600E Mutation in Iranian Patients with Papillary Thyroid Carcinoma: A Single-Center Study. J Appl Sci. 2009;9(19)

Table 1.

Frequency of Important Parameters in Colorectal Cancer Patients a

ParameterPercent, %
Gender
Female45
Male55
Tumor site
Right side30
Left side70
Tumor type
Conventional94
Mucinous6
Tumor grade
Well differentiated83
Moderately differentiated17
Poorly differentiated0
Tumor stage, TNM
I18
II48
III30
IV4
a Abbreviation: TNM, Tumor node metastasis.

Table 2.

BRAF Gene Mutation Frequency in Some Unselected Specimens of CRCs a

Study (Reference)CountryYearNumber of PatientsMutated BRAF, No. (%)Detection Method
Nagasaka (23)Japan200423421 (9)PCR-RFLP
Samowitz (24)US200591187 (9.5)DS
Miranda (25)Italy20062027 (3.5)PCR-RFLP
Wei Qi Li (10)Australia200627523 (8.9)PCR-SSCP
Samowitz (26)US20061271123 (9.7)DS
Maestro (27)Spain200732412 (3.7)Real time-PCR and DS
Lee (28)South Korea20081346 (4.5)PCR-RFLP
Bougatef (29)Tunis2008484 (8)DS
Asaka (30)Japan200990841 (4.5)PCR-RFLP
Vilkin (31)Israel201085 b, 43 c20 (23.5) b, 9 (20.9) aDS
Li (32)China201120014 (6.5)PCR-Pyrosequencing
Naghibalhosaini (20)Iran20111100 (0)PCR-RFLP
Luevano-Gonzalez (33)Mexico20111050 (0)Real time PCR
Band (34)Australia20121052128 (12.2)Allele discriminating assay
Sylvester (35)U.S201241832 (8)PCR-DS
Li-liny Hsieh (36)Taiwan20121822 (1.2)HRM and DS
Palomba (37)Italy-Sardinia island20124751 (0.3)PCR-DS
Chaiyapan (38)Thailand20131330 (0)PCR-DS and HRM
Yip WK (39)Malaysia2013431 (2.3)Real time-PCR
Aissi (40)Tunis2013511 (2)DS
Ghaffarpour (22)Iran2011271 (3.7)DS
a Abbreviations: PCR, polymerase chain reaction; RFLP, Restriction fragment length polymorphism; SSCP, Single strand conformational polymorphism; HRM, High resolution melting.
b Jewish Patients.
c Arab Patients.

Figure 1.

Agarose Gel Electrophoresis of PCR (polymerase chain reaction) Products
1: Negative control; 2: 50 bp ladder, 3: patient sample and 4: positive control

Figure 2.

Wild-Type BRAF Gene in a Patient Sample

Figure 3.

Mutated BRAF Gene in Positive Control Specimen